RNA World/Project description/Fileformats/en

Aus Rechenkraft
Zur Navigation springen Zur Suche springen

Fasta

>alaT
GGGGCUAUAG CUCAGCUGGG AGAGCGCCUG CUUUGCACGC AGGAGGUCUG CGGUUCGAUC
CCGCAUAGCU CCACCA
  • Note that the spaces are not required and will be ignored.

Covariance Model (CM)

Stockholm (STO)

# STOCKHOLM 1.0
#=GF ID    UPSK
#=GF SE    Predicted; Infernal 
#=GF SS    Published; PMID:9223489
#=GF RN    [1]
#=GF RM    9223489
#=GF RT    The role of the pseudoknot at the 3' end of turnip yellow mosaic
#=GF RT    virus RNA in minus-strand synthesis by the viral RNA-dependent RNA
#=GF RT    polymerase.
#=GF RA    Deiman BA, Kortlever RM, Pleij CW;
#=GF RL    J Virol 1997;71:5990-5996.
AF035635.1/619-641             UGAGUUCUCGAUCUCUAAAAUCG
M24804.1/82-104                UGAGUUCUCUAUCUCUAAAAUCG
J04373.1/6212-6234             UAAGUUCUCGAUCUUUAAAAUCG
M24803.1/1-23                  UAAGUUCUCGAUCUCUAAAAUCG
#=GC SS_cons                   .AAA....<<<<aaa....>>>>
//

...